Zhiyan-Le, 2021-04-29.
https://zhiyanleback.blogspot.com/p/two-candidates-re-sars-2-origin.html
https://sites.google.com/site/zhiyanleback/2021-1/z20210429-two-origins
Key Words: Science and research communications, SARS-2, Covid-19.
There are two possible candidates regarding the SARS-2 origin. One is bat RaTG13, as the WHO-China joint report said. The other is WIV1 series (Wuhan Institute of Virology, No.1 virus. Totally, it has 8 bat samples, plus WIV16). The following are key info/data suggesting that RaTG13 is too good to be true as the SARS-2 origin and that WIV1 is the real origin.
Samples for this essay:
Samples, Raw Data Souce: NIH GenBank. | ||
Name | GenBank ID | Descriptions |
WH-01 | NC_045512.1 | Basic sample, Wuhan patient. |
URL: | https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.1 | |
WIV1 | KF367457.1 | Bat SARS-like coronavirus WIV1, lab product by PRC WIV. |
URL: | https://www.ncbi.nlm.nih.gov/nucleotide/KF367457.1 | |
RaTG13 | MN996532.1 | Bat coronavirus RaTG13, said collected in PRC Yunnan, 2013. |
URL: | https://www.ncbi.nlm.nih.gov/nuccore/MN996532.1 | |
Bat-12 | NC_028824.1 | Bat coronavirus, collected in PRC Yunnan, 2012. |
URL: | https://www.ncbi.nlm.nih.gov/nuccore/971746735 | |
Bat-14 | NC_030886.1 | Bat coronavirus, collected in PRC Yunnan, 2014. |
URL: | https://www.ncbi.nlm.nih.gov/nuccore/NC_030886.1 |
Note: If RaTG13 were really a natural bat sample, its nCov should behave as the same, or at least very close to, how the other two natural bat samples do.
And here is the alignment on single-gene level:
Global Align re Samples (Raw data and Method: NIH BLAST, by 2021-02) | ||||
Query x Subject | S-Gene | Complete Sequence | ||
Identities | Gaps | Identities | Gaps | |
RaTG13 x NC-045512 | 98% | 0% | 96% | 0% |
RaTG13 x WIV1 | 88% | 2% | 78% | 3% |
RaTG13 x Bat-2012 | 57% | 19% | 55% | 16% |
RaTG13 x Bat-2014 | 61% | 13% | 56% | 12% |
NC-045512 x Bat-2012 | 57% | 19% | 55% | 16% |
NC-045512 x Bat-2014 | 61% | 13% | 56% | 12% |
WIV1 x NC-045512 | 87% | 2% | 78% | 3% |
Taking WH-01(NC_045512) as the basic sample, RaTG13 has highest identities, and much higher than that of two natural bat sample (2012 and 2014). Question: in the same location (PRC, Yunnan Province) and in just one year, how come in nature that the nCov in RaTG13 could be mutated so close to a patient sample which will be coming over 6.5 years later? However, a lab can do it in 10 days.
And here are similarities on Codon-level:
S-Gene: Codon-Leveled Similarities to NC-045512 | |||||
NC-045512 | WIV1 | RaTG13 | Bat-2012 | Bat-2014 | |
Length by Codon | 1273 | 1260 | 1256 | 1269 | 1132 |
Matching Score | 78 | 693 | 66 | 94 | |
Matching Ratio | 0.0619 | 0.5518 | 0.0520 | 0.0830 | |
ATG | 14 | 17 | 14 | 21 | 29 |
TAA | 0 | 0 | 0 | 0 | 0 |
TAG | 0 | 0 | 0 | 0 | 0 |
TGA | 0 | 0 | 0 | 0 | 0 |
Again, the similarity score of RaTG13 goes much, much higher than that of natural bat samples and, for the codon ATG, RaTG13 has it exactly as the same as what the Wuhan patient (NC_045512) has. Is this possible in natural mutations? Obviously not.
The RaTG13 sample has two versions: one is issued at 2020-03-24 and the new version is issued at 2020-11-24. And here is their aligned result by NIH Blast:
Alignment of RaTG13: V.1 (2020-03-24) x V.2 (2020-11-24) |
v.1 (2020-03-24): https://www.ncbi.nlm.nih.gov/nuccore/MN996532.1 |
v.2 (2020-11-24): https://www.ncbi.nlm.nih.gov/nuccore/MN996532.2 |
Query Length: 29855 (v.1) |
Subject Length: 29855 (v.2) |
Identities: 29834/29870 (99%) |
Query 1 CTTTCCAGGTAACAAACCAACGAACTCTCGATCTCTTGTAGATCT 45 |
||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct 1 ATTAAAGGTTTATACCTTTCCAGGTAACAAACCAACGAACTCTCGATCTCTTGTAGATCT 60 |
Query 2086 GCTAACAAATATCTTTGGCACTGTCTATGAGCAACTCAAACCTGTTCTTGATTGGCTCGA 2145 |
|||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
Sbjct 2101 GCTAACAAATATCTTTGGCACTGTTTATGAGAAACTCAAACCTGTTCTTGATTGGCTCGA 2160 |
Query 6886 TTCATTTAATTACCTGAAGTCACCTAATTTTTTTACATTGATTAATATTATAATTTGGTT 6945 |
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
Sbjct 6901 TTCATTTAATTACCTGAAGTCACCTAATTTTTTTAAATTGATTAATATTATAATTTGGTT 6960 |
Query 7066 TACTAATGTCACTACAGCAATCTACTGTACTGGTTCTATACCTTGTGGTGTTTGTCTTAG 7125 |
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
Sbjct 7081 TACTAATGTCACTACAGCAATCTACTGTACTGGTTCTATACCTTGTAGTGTTTGTCTTAG 7140 |
Query 29806 GTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAA 29855 |
||||||||||||||||||||||||||||||||||| |
Sbjct 29821 GTGATTTTAATAGCTTCTTAGGAGAATGACAAAAA 29855 |
That is blasted on single-gene level. It shows a 99% identity with a few allele changes and a 15-bp gap (ATTAAAGGTTTATAC). To summarize:
RaTG13 v.1(Ref) and v.2 (Alt): Codon Changes | ||||||||||||||||||
BC | Hidden Codons | BC | Hidden Codon Values | BC-Gain | Total Gain | |||||||||||||
I | II | III | IV | V | VI | I | II | III | IV | V | VI | SUM | ||||||
Ref | CTA | GCA | CGT | TGC | ACA | TGG | TAC | 29 | 37 | 28 | 58 | 5 | 59 | 50 | 266 | 32 | -13 | |
Alt | TTA | AGC | TCG | TAG | CAT | CGG | CTA | 61 | 10 | 55 | 51 | 20 | 27 | 29 | 253 | |||
Ref | GCA | TGA | GTC | CTG | AGA | CTT | CAG | 37 | 57 | 46 | 31 | 9 | 32 | 19 | 231 | -4 | 24 | |
Alt | GAA | GTC | GTC | AGT | CAG | TCA | GTC | 33 | 46 | 46 | 12 | 19 | 53 | 46 | 255 | |||
Ref | TAC | TCG | TGA | AGT | CTC | AGG | ACT | 50 | 55 | 57 | 12 | 30 | 11 | 8 | 223 | -1 | 18 | |
Alt | TAA | TCG | GTC | CTG | AGA | CTT | CAG | 49 | 55 | 46 | 31 | 9 | 32 | 19 | 241 | |||
Ref | TGG | CTA | CTA | ATC | GCG | ATG | CTA | 59 | 29 | 29 | 14 | 39 | 15 | 29 | 214 | -8 | 141 | |
Alt | TAG | TCG | TAC | TCA | GAG | TCC | TGA | 51 | 55 | 50 | 53 | 35 | 54 | 57 | 355 | |||
Ref | CGC | TAC | ATG | TGC | AGG | ACA | CGT | 26 | 50 | 15 | 58 | 11 | 5 | 28 | 193 | 5 | 37 | |
Alt | CTG | GCA | TAC | CAT | GTG | CAA | CGT | 31 | 37 | 50 | 20 | 47 | 17 | 28 | 230 |
In the above, BC refers to Basic Codon, of which each has its own 6 hidden codons. Hidden codon value refers to energy level corresponding to each codon.
It shows that RaTG13 version 2 gained 207 units on gene-energy-level. Question is: How could the change and its energy gain naturally happen as the WIV leaders said that they have genomic sequence without live-sample regarding the bat RaTG13 nCov?
Regarding the 15-bp gap (ATTAAAGGTTTATAC), here is a comparison:
Assesion | Name | Genomic Data |
NC_045512.1 | WH01-1 | CGGTGACGCATACAA AACATTCCCACCATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGT |
NC_045512.2 | WH01-2 | ATTAAAGGTTTATAC CTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA |
MT511081.1 | Poland+ | ATTAAAGGTTTATAC CTTTCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA |
MN996532.1 | RaTG13-1 | CTTTCCAGGTAACAAACCAACGAACTCTCGATCTCTTGTAGATCTGTTCTCTAAA |
MN996532.2 | RaTG13-2 | ATTAAAGGTTTATAC CTTTCCAGGTAACAAACCAACGAACTCTCGATCTCTTGTAGATCTGTTCTCTAAA |
The genomic data comes from each sample (Poland+, NIH Blast-Search result: hundreds 100% identical samples re patients around the world. Taking the first one, Poland.).
Question: where does the 15-bp gap come from? How does it go exactly the same 15-bp gap come to both RaTG13 (with no live-sample) and patients around the world in almost the same time around 2020 autumn?
There is only one convincing answer to the above questions, that is, RaTG13 nCov is a lab product made for similarities or identities as close as possible to that of patient samples so as to cover up the real SARS-2 origin, such as WIV1.
Regarding the changes for RaTG13 gene data, here is the relevant info by USRTK:
RATG13: ALTERED DATASETS RAISE MORE QUESTIONS ABOUT RELIABILITY OF KEY STUDIES ON CORONAVIRUS ORIGINS.
Posted on December 29, 2020.
NO PEER REVIEW FOR ADDENDUM TO PROMINENT CORONAVIRUS ORIGINS STUDY?
Posted on December 18, 2020
URL: https://usrtk.org/tag/ratg13/
It says that, when updating RaTG13 genomic sequence data, the provider, PRC-WIV, did not give a clear reason, nor did they go through peer-review and other normal processes.
Speaking of WIV1, its identities (87% to basic sample) should be good enough as the SARS-2 origin. The provider PRC-WIV said that it is a bat-nCov sample. However, in international meetings, it was reviewed and approved as a lab-product. For example:
The University of North Carolina, Institutional Biosafety Committee Meeting Minutes, Jan.09,2019 3:30 PM. Burnett-Womack 9001 | |
60350 | Infectious clones of bat SARS-like coronaviruses WIV1-CoV and SHC-014 (including reporter-expressing variants) or expressing WIV1 or SHC014 Spike genes - 2019. Renewal |
APPROVED | Summary: The aim of this study is to generate reverse genetic infectious clones of bat SARS- like coronaviruses WIV1-CoV and SHC-014, which are genetically similar to. Additionally, to determine if the Spike proteins from these viruses are sufficient to confer infectivity, the Spike genes from the bat viruses will be introduced into the genome background. Replication of recombinant viruses will be monitored through viral passage in cells and infectious of mice. Committee Comments: The proposed containment and safety procedures are adequate for the experimental design. Community Comments: None. III-D, BSL-3, plasmids, mice. |
60351 | Ralph Baric Transposon mutagenesis of WIV16-CoV to identify genetically flexible regions of CoV genomes |
APPROVED | Summary: The aim of this experiment is to generate a transposon mutant library spanning the WIVI6-CoV genome. The virus library will be screened in cell culture for viral fitness via passage in cell lines. Additionally, the screen will be interrogated for genes responsible for interferon antagonism or RNA replication fidelity. Committee Comments: The proposed containment and safety procedures are adequate for the experimental design. Community Comments: None III-D, BSL-3, plasmids |
Link :: https://2f7nhsvfj5dyz0312njuuj14-wpengine.netdna-ssl.com/wp-content/uploads/2020/08/For-Production-to-Requestor-IBC-Meeting-Minutes.pdf |
In the above re BP genes frequency and distribution on Codon level, WIV1 has the smallest distance from patient sample (NC_045512), while RaTG13 has three times bigger distance than that of WIV1 and obviously different from that of natural samples. See below:
Global Codon BP Freq.Distribution (raw data:NIH GenBank, by 2021-02) | |||||
NC_045512 | WIV1 | RaTG13 | Bat-12 | Bat-14 | |
A | 3038.33 | 2884.67 | 2975.33 | 2342.33 | 2552.33 |
C | 1868.00 | 2020.67 | 1836.67 | 1462.67 | 2135.67 |
G | 1983.67 | 2098.00 | 1948.67 | 1936.00 | 2419.00 |
T | 3267.00 | 3099.67 | 3190.33 | 3250.00 | 2946.00 |
total: | 10157 | 10103 | 9951 | 8991 | 10053 |
avrg: | 2539.25 | 2525.75 | 2487.75 | 2247.75 | 2513.25 |
total gap w NC_045512 | -54 | -206 | -1166 | -104 | |
avrg gap w NC_045512 | -14 | -52 | -292 | -26 |
In more detailed terms, WIV1 and RaTG13 behave the same way:
SARS-2: Global Codon Frequency & Distribution (raw data: NIH GenBank, by 2021-02-22) | |||||||||||||||
NC_045512 | WIV1 | RaTG13 | Bat-12 | Bat-14 | |||||||||||
1st | 2nd | 3rd | 1st | 2nd | 3rd | 1st | 2nd | 3rd | 1st | 2nd | 3rd | 1st | 2nd | 3rd | |
A | 3075 | 2903 | 3137 | 3061 | 2855 | 2738 | 2828 | 3087 | 3011 | 2316 | 2091 | 2620 | 2754 | 2547 | 2356 |
C | 2132 | 1610 | 1862 | 2051 | 2135 | 1876 | 1599 | 1838 | 2073 | 1555 | 1387 | 1446 | 2000 | 2285 | 2122 |
G | 1525 | 1909 | 2517 | 2389 | 1629 | 2276 | 1921 | 2466 | 1459 | 1692 | 1852 | 2264 | 2729 | 2014 | 2514 |
T | 3425 | 3735 | 2641 | 2602 | 3484 | 3213 | 3603 | 2560 | 3408 | 3428 | 3661 | 2661 | 2570 | 3207 | 3061 |
total: | 10157 | 10103 | 9951 | 8991 | 10053 | ||||||||||
avrg: | 2539.25 | 2525.75 | 2487.75 | 2247.75 | 2513.25 | ||||||||||
align w NC_045512: | 0.99468 | 0.97972 | 0.88520 | 0.98976 |
In the above, 1st-2nd-3rd refer to three base genes. In terms of Codons frequency and distribution, which in fact the virus and ACE2 run and interact with each other, WIV1 has the highest score, 0.99468, to that of patient sample (NC_45512), while RaTG13 has clearly lower ration and obviously different from natural bat samples.
In sum, between the two candidates of SARS-2 origin, WIV1 is the real one; RaTG13 is not the SARS-2 origin, nor is it a natural sample.
In March 2016, PNAS (publication by US National Academy of Science) published an article with editor’s notes about the WIV1. Please see:
This Issue, by PNAS March 15, 2016 113 (11) 2793-2795;
https://www.pnas.org/content/113/11/2793
it warned that WIV1 is a lab nCov product, which can directly jump to humans and cause huge pandemic with global economic loses, can even change existing living styles. Now the warning is a big reality that the US and the whole world are facing.
RaTG13 Is Too Good To Be True.
---- WIV1 pk RaTG13 (2).
Zhiyan-Le, 2021-04-03.
https://sites.google.com/site/zhiyanleback/2021-1/z20210404-wiv1xratg13
https://zhiyanleback.blogspot.com/p/ratg13-is-too-good-to-be-true.html
WHO China trip and its SARS-2 origin report indicated RaTG13 as the SARS-2 origin from nature. Their conclusion was base on: 1]: RaTG13 has 96.2% identity, which was done on the single gene alignment level. 2]: There is only one Amino-Acid difference, which was done on the protein alignment level.
Such conclusion may not stand true. Reason: Alignment and analysis on Codon level are totally ignored, which may lead to different conclusions. Let’s take an example, we have two genomic sequences with the same Am-Acid but different Codons:
First: | ||||||||||||||
Arg | Phe | Glu | Arg | Arg | Ser | Leu | Gly | Ser | Ser | Arg | Pro | Thr | Cys | Cys |
AGG | TTC | GAG | CGC | CGG | AGT | CTC | GGC | TCA | TCC | CGA | CCG | ACT | TGC | TGT |
Second: | ||||||||||||||
Arg | Phe | Glu | Arg | Arg | Ser | Leu | Gly | Ser | Ser | Arg | Pro | Thr | Cys | Cys |
CGT | TTT | GAA | AGG | CGT | TCC | TTA | GGA | TCC | TCA | CGG | CCC | ACC | TGT | TGC |
Their identities on the Am-Acid or protein level is 100%. And their identities on the single gene alignment level is 56%. See below:
Identities | 25/45(56%) |
Query 1 AGGTTCGAGCGCCGGAGTCTCGGCTCATCCCGACCGACTTGCTGT 45 | |
| || || | || | || || || || || || || || | |
Sbjct 1 CGTTTTGAAAGGCGTTCCTTAGGATCCTCACGGCCCACCTGTTGC 45 |
However, their identities on the Codon level: 0%. More over, their structures are different:
Which is accurate? In my view, the one on Codon level is. The reason is simple: When the virus and ACE2 are running, they work on the Codon level. The given samples may have the same Am-Acid, however, their energy level or power can be very different due to their different Codons. This can be well explained by the binary-image Codon Table and by the Buckyball system.
RaTG13 Reality on the Codon Level.
Now using Codon study to see the identities among relevant nCov samples (with GenBank ID):
• NC_045512: WH-01, basic sample, collected from a patient in Wuhan hospital in PRC.
• MN996532: bat RaTG13, said as the most possible origin of SARS-2.
• KF367457: WIV1, the first one of lab-product series of SARS-like nCov.
• NC_028824, Bat-2012, natural bat, collected in PRC Yunnan, 2012.
• NC_030886, Bat-2014. natural bat, collected in PRC Yunnan, 2014
If RaTG13 were a bat from nature in 2013, it should behave as the same or very closely to the two natural bat sample, Bat-2012 and Bat-2014.
Aligning with the basic sample, WH-01 (NC_45512), on the global Codon level, the RaTG13 has a matching score of 184 and WIV1 has 190. And here is the alignment of their Codon base-gene occurring frequency & distribution:
Table 01:
Global Codon BP Freq.Distribution (raw data:NIH GenBank, by 2021-02) | |||||
NC_045512 | WIV1 | RaTG13 | Bat-12 | Bat-14 | |
A | 3038.33 | 2884.67 | 2975.33 | 2342.33 | 2552.33 |
C | 1868.00 | 2020.67 | 1836.67 | 1462.67 | 2135.67 |
G | 1983.67 | 2098.00 | 1948.67 | 1936.00 | 2419.00 |
T | 3267.00 | 3099.67 | 3190.33 | 3250.00 | 2946.00 |
total: | 10157 | 10103 | 9951 | 8991 | 10053 |
avrg: | 2539.25 | 2525.75 | 2487.75 | 2247.75 | 2513.25 |
total gap w NC_45512 | -54 | -206 | -1166 | -104 | |
avrg gap w NC_45512 | -14 | -52 | -292 | -26 |
The aligning result: WIV1 has the total gap [-54] and average gap [-14] , and RaTG13 has that of [-206] and [-53]. Both Bat-2012 and Bat-2014 have much bigger gaps.
Clearly, WIV1 is the closest to the basic sample, meaning an obvious greater possibility to be the SARS-2 origin than that of RaTG13, which behaves very differently from natural bat samples.
Ratg13: Too Good To Be True As The SARS-2 Origin.
This indicator, Codon and its genetic frequencies and distribution, is important, according to PRC-PLA doctor Chen Wei (a top virology scientist and Covid-vaccine developer in China; also, she is a leader in charge of medical treatment during the early stage of the pandemic in PRC Wuhan City), because it directly tells the similarity or difference regarding affinity, stability and mutation status and trend, especially genes C & G and their quantity and distribution.
S-Gene is a key factor re SARS-2 interacts with human body. Let’s do some studies on the Codon level by borrowing Dr. Chen Wei suggestion. Below are similarities among the taken samples.
Fig. 01:
Indeed, as Dr. Chen Wei suggested, gene C & G, as well as their quantity and distribution, play an important role, particularly in the Codon 3rd BP genes (where base-gene A & T are 0).
It seems that RaTG13 is in a good position to be the SARS-2 origin: Regarding single gene-aligning closeness to the basic sample NC_045512, WIV1 has a ratio of 0.9866, and RaTG13 has a ratio of 0.9969. However, comparing with natural bats (Bat-2012 and Bat-2014), of which one has the ratio of 0.8892 and another has it of 1.0134, far enough to be role out as the SARS-2 origin by the said sample. That is, sample RaTG13 behaves very differently from natural bats, but it does not.
Further, below is the Codon-leveled aligning result:
Table 02:
Codon-Leveled Similarities to NC-045512 | ||||
WIV1 | RaTG13 | Bat-2012 | Bat-2014 | |
Total Occurring | 1260 | 1256 | 1269 | 1132 |
similarities | 78 | 693 | 66 | 94 |
Ratio of similarity/total | 0.0619 | 0.5518 | 0.0520 | 0.0830 |
The sample RaTG13 has a matching score of 693 occurring aligning similarities, others have it from 87 to 96. The gap between RaTG13 and natural bats is too big to believe that it comes from nature. In a lab field, however, it is pretty easy to reach or even to go beyond 693 similarities score. Besides, RaTG13 similarity ratio is too close to the basic sample but too far from the natural samples. In fact, when using NIH-BLAST to search RaTG13’s all possible similarities, the result has no natural bats but in three categories: synthetic construct, clones, and vaccines, all are lab/man-made work.
In sum, the indicator on Codon level should be in the must-do-list when searching the SARS-2 origin(s). By using it, the picture is very different from what the WHO report said. That is, the sample RaTG13 is too perfect to be a truthful SARS-2 origin from natural bats, rather, it is very likely a lab-product. In contrast, and by all indicators, particularly on the Codon level, WIV1 has the closest relations with basic sample NC_044512, that is, WIV1 is the most possible SARS-2 origin.
Reference:
Message from PLA Vaccine Patent. 2021-03-15.
https://sites.google.com/site/zhiyanleback/2021-1/z20210315-patent-message-en
Data Availability
Table 01-02 (supplement)
SARS-2: Global Codon Freq. & Distribution (raw data: NIH GenBank, by 2021-02-22) | |||||||||||
WH-01 | WIV1 | RaTG13 | Bat-12 | Bat-14 | WH-01 | WIV1 | RaTG13 | Bat-12 | Bat-14 | ||
AAA | 284 | 264 | 312 | 132 | 180 | CAA | 230 | 207 | 243 | 129 | 157 |
AAC | 219 | 186 | 200 | 129 | 210 | CAC | 192 | 151 | 152 | 98 | 125 |
AAG | 252 | 239 | 116 | 114 | 213 | CAG | 184 | 165 | 84 | 129 | 183 |
AAT | 188 | 233 | 264 | 150 | 179 | CAT | 181 | 163 | 165 | 125 | 130 |
ACA | 276 | 283 | 235 | 175 | 219 | CCA | 101 | 141 | 113 | 79 | 150 |
ACC | 127 | 135 | 145 | 89 | 162 | CCC | 44 | 43 | 43 | 31 | 75 |
ACG | 62 | 52 | 46 | 60 | 89 | CCG | 27 | 21 | 30 | 28 | 72 |
ACT | 165 | 246 | 247 | 155 | 239 | CCT | 93 | 115 | 107 | 69 | 142 |
AGA | 201 | 149 | 266 | 137 | 106 | CGA | 36 | 27 | 37 | 28 | 33 |
AGC | 109 | 86 | 141 | 92 | 143 | CGC | 29 | 44 | 39 | 23 | 100 |
AGG | 131 | 108 | 113 | 124 | 112 | CGG | 24 | 29 | 28 | 18 | 40 |
AGT | 161 | 143 | 201 | 146 | 162 | CGT | 50 | 79 | 63 | 65 | 108 |
ATA | 180 | 168 | 106 | 191 | 166 | CTA | 274 | 215 | 119 | 243 | 211 |
ATC | 127 | 131 | 104 | 83 | 81 | CTC | 120 | 147 | 84 | 79 | 93 |
ATG | 298 | 357 | 122 | 319 | 311 | CTG | 271 | 248 | 79 | 211 | 203 |
ATT | 295 | 281 | 210 | 220 | 182 | CTT | 276 | 256 | 213 | 200 | 178 |
WH-01 | WIV1 | RaTG13 | Bat-12 | Bat-14 | WH-01 | WIV1 | RaTG13 | Bat-12 | Bat-14 | ||
GAA | 100 | 199 | 182 | 91 | 141 | TAA | 289 | 100 | 319 | 248 | 76 |
GAC | 76 | 145 | 133 | 57 | 143 | TAC | 201 | 183 | 252 | 169 | 214 |
GAG | 97 | 178 | 78 | 69 | 161 | TAG | 211 | 106 | 123 | 142 | 102 |
GAT | 64 | 173 | 185 | 79 | 159 | TAT | 135 | 163 | 279 | 230 | 174 |
GCA | 99 | 187 | 118 | 107 | 191 | TCA | 193 | 215 | 183 | 120 | 130 |
GCC | 47 | 78 | 69 | 53 | 131 | TCC | 79 | 61 | 72 | 66 | 98 |
GCG | 29 | 47 | 19 | 58 | 107 | TCG | 40 | 63 | 33 | 50 | 55 |
GCT | 89 | 261 | 179 | 114 | 260 | TCT | 139 | 187 | 199 | 133 | 165 |
GGA | 74 | 95 | 124 | 66 | 98 | TGA | 258 | 87 | 305 | 251 | 92 |
GGC | 49 | 73 | 89 | 62 | 137 | TGC | 193 | 150 | 244 | 183 | 193 |
GGG | 51 | 50 | 50 | 43 | 70 | TGG | 195 | 110 | 253 | 208 | 179 |
GGT | 62 | 195 | 155 | 118 | 226 | TGT | 286 | 204 | 358 | 288 | 215 |
GTA | 180 | 153 | 129 | 198 | 192 | TTA | 362 | 248 | 220 | 425 | 214 |
GTC | 70 | 106 | 99 | 91 | 115 | TTC | 180 | 157 | 207 | 141 | 102 |
GTG | 279 | 212 | 97 | 266 | 315 | TTG | 366 | 291 | 188 | 425 | 302 |
GTT | 159 | 237 | 215 | 220 | 283 | TTT | 298 | 277 | 368 | 349 | 259 |
Table 02-02 (supplement)
S-Gene: Global Codon Matching Score (raw data: NIH GenBank, 2021-02-22) | |||||||||
WIV1 | RaTG13 | Bat-12 | Bat-14 | WIV1 | RaTG13 | Bat-12 | Bat-14 | ||
AAA | 0 | 0 | 0 | 0 | CAA | 0 | 0 | 0 | 0 |
AAC | 3 | 51 | 4 | 9 | CAC | 0 | 8 | 0 | 0 |
AAG | 2 | 31 | 0 | 0 | CAG | 4 | 24 | 1 | 2 |
AAT | 0 | 0 | 0 | 0 | CAT | 0 | 0 | 0 | 0 |
ACA | 0 | 0 | 0 | 0 | CCA | 0 | 0 | 0 | 0 |
ACC | 7 | 57 | 8 | 14 | CCC | 2 | 37 | 2 | 5 |
ACG | 0 | 0 | 0 | 0 | CCG | 0 | 0 | 0 | 0 |
ACT | 0 | 0 | 0 | 0 | CCT | 0 | 0 | 0 | 0 |
AGA | 0 | 0 | 0 | 0 | CGA | 0 | 0 | 0 | 0 |
AGC | 11 | 52 | 11 | 8 | CGC | 0 | 0 | 0 | 0 |
AGG | 2 | 24 | 2 | 1 | CGG | 0 | 0 | 0 | 0 |
AGT | 0 | 0 | 0 | 0 | CGT | 0 | 0 | 0 | 0 |
ATA | 0 | 0 | 0 | 0 | CTA | 0 | 0 | 0 | 0 |
ATC | 5 | 35 | 3 | 3 | CTC | 0 | 0 | 0 | 0 |
ATG | 1 | 5 | 2 | 2 | CTG | 7 | 59 | 7 | 14 |
ATT | 0 | 0 | 0 | 0 | CTT | 0 | 0 | 0 | 0 |
WIV1 | RaTG13 | Bat-12 | Bat-14 | WIV1 | RaTG13 | Bat-12 | Bat-14 | ||
GAA | 0 | 0 | 0 | 0 | TAA | 0 | 0 | 0 | 0 |
GAC | 2 | 32 | 3 | 1 | TAC | 2 | 33 | 2 | 4 |
GAG | 1 | 22 | 0 | 1 | TAG | 0 | 0 | 0 | 0 |
GAT | 0 | 0 | 0 | 0 | TAT | 0 | 0 | 0 | 0 |
GCA | 0 | 0 | 0 | 0 | TCA | 0 | 0 | 0 | 0 |
GCC | 7 | 38 | 5 | 9 | TCC | 0 | 0 | 0 | 0 |
GCG | 0 | 0 | 0 | 0 | TCG | 0 | 0 | 0 | 0 |
GCT | 0 | 0 | 0 | 0 | TCT | 0 | 0 | 0 | 0 |
GGA | 0 | 0 | 0 | 0 | TGA | 0 | 0 | 0 | 0 |
GGC | 4 | 49 | 4 | 5 | TGC | 5 | 23 | 0 | 3 |
GGG | 0 | 0 | 0 | 0 | TGG | 0 | 7 | 1 | 0 |
GGT | 0 | 0 | 0 | 0 | TGT | 0 | 0 | 0 | 0 |
GTA | 0 | 0 | 0 | 0 | TTA | 0 | 0 | 0 | 0 |
GTC | 0 | 0 | 0 | 0 | TTC | 5 | 46 | 6 | 2 |
GTG | 8 | 60 | 5 | 11 | TTG | 0 | 0 | 0 | 0 |
GTT | 0 | 0 | 0 | 0 | TTT | 0 | 0 | 0 | 0 |
=-=
Comments
Post a Comment